UCSC Genome Bioinformatics
   Home  -   Genomes  -   Blat  -   Tables  -   Gene Sorter  -   PCR  -   Proteome  -   Help
  Frequently Asked Questions: Data File Formats
 

Return to FAQ Table of Contents



  BED format
 

BED format provides a flexible way to define the data lines that are displayed in an annotation track. BED lines have three required fields and nine additional optional fields. The number of fields per line must be consistent throughout any single set of data in an annotation track. The order of the optional fields is binding: lower-numbered fields must always be populated if higher-numbered fields are used.

The first three required BED fields are:

  1. chrom - The name of the chromosome (e.g. chr3, chrY, chr2_random) or scaffold (e.g. scaffold10671).
  2. chromStart - The starting position of the feature in the chromosome or scaffold. The first base in a chromosome is numbered 0.
  3. chromEnd - The ending position of the feature in the chromosome or scaffold. The chromEnd base is not included in the display of the feature. For example, the first 100 bases of a chromosome are defined as chromStart=0, chromEnd=100, and span the bases numbered 0-99.

The 9 additional optional BED fields are:

  1. name - Defines the name of the BED line. This label is displayed to the left of the BED line in the Genome Browser window when the track is open to full display mode or directly to the left of the item in pack mode.
  2. score - A score between 0 and 1000. If the track line useScore attribute is set to 1 for this annotation data set, the score value will determine the level of gray in which this feature is displayed (higher numbers = darker gray). This table shows the Genome Browser's translation of BED score values into shades of gray:
    shade                  
    score in range   ≤ 166 167-277 278-388 389-499 500-611 612-722 723-833 834-944 ≥ 945
  3. strand - Defines the strand - either '+' or '-'.
  4. thickStart - The starting position at which the feature is drawn thickly (for example, the start codon in gene displays).
  5. thickEnd - The ending position at which the feature is drawn thickly (for example, the stop codon in gene displays).
  6. itemRgb - An RGB value of the form R,G,B (e.g. 255,0,0). If the track line itemRgb attribute is set to "On", this RBG value will determine the display color of the data contained in this BED line. NOTE: It is recommended that a simple color scheme (eight colors or less) be used with this attribute to avoid overwhelming the color resources of the Genome Browser and your Internet browser.
  7. blockCount - The number of blocks (exons) in the BED line.
  8. blockSizes - A comma-separated list of the block sizes. The number of items in this list should correspond to blockCount.
  9. blockStarts - A comma-separated list of block starts. All of the blockStart positions should be calculated relative to chromStart. The number of items in this list should correspond to blockCount.

Example:
Here's an example of an annotation track that uses a complete BED definition:

track name=pairedReads description="Clone Paired Reads" useScore=1
chr22 1000 5000 cloneA 960 + 1000 5000 0 2 567,488, 0,3512
chr22 2000 6000 cloneB 900 - 2000 6000 0 2 433,399, 0,3601


  bigBed format
 

The bigBed format stores annotation items that can either be simple, or a linked collection of exons, much as bed files do. BigBed files are created initially from bed type files, using the program bedToBigBed. The resulting bigBed files are in an indexed binary format. The main advantage of the bigBed files is that only the portions of the files needed to display a particular region are transferred to UCSC, so for large data sets bigBed is considerably faster than regular bed files. The bigBed file remains on your web accessible server (http, https, or ftp), not on the UCSC server.

Click here for more information on the bigBed format.



  PSL format
 

PSL lines represent alignments, and are typically taken from files generated by BLAT or psLayout. See the BLAT documentation for more details. All of the following fields are required on each data line within a PSL file:

  1. matches - Number of bases that match that aren't repeats
  2. misMatches - Number of bases that don't match
  3. repMatches - Number of bases that match but are part of repeats
  4. nCount - Number of 'N' bases
  5. qNumInsert - Number of inserts in query
  6. qBaseInsert - Number of bases inserted in query
  7. tNumInsert - Number of inserts in target
  8. tBaseInsert - Number of bases inserted in target
  9. strand - '+' or '-' for query strand. For translated alignments, second '+'or '-' is for genomic strand
  10. qName - Query sequence name
  11. qSize - Query sequence size
  12. qStart - Alignment start position in query
  13. qEnd - Alignment end position in query
  14. tName - Target sequence name
  15. tSize - Target sequence size
  16. tStart - Alignment start position in target
  17. tEnd - Alignment end position in target
  18. blockCount - Number of blocks in the alignment (a block contains no gaps)
  19. blockSizes - Comma-separated list of sizes of each block
  20. qStarts - Comma-separated list of starting positions of each block in query
  21. tStarts - Comma-separated list of starting positions of each block in target

Example:
Here is an example of an annotation track in PSL format. Note that line breaks have been inserted into the PSL lines in this example for documentation display purposes. Click here for a copy of this example that can be pasted into the browser without editing.

track name=fishBlats description="Fish BLAT" useScore=1
59 9 0 0 1 823 1 96 +- FS_CONTIG_48080_1 1955 171 1062 chr22
    47748585 13073589 13073753 2 48,20,  171,1042,  34674832,34674976,
59 7 0 0 1 55 1 55 +- FS_CONTIG_26780_1 2825 2456 2577 chr22
    47748585 13073626 13073747 2 21,45,  2456,2532,  34674838,34674914,
59 7 0 0 1 55 1 55 -+ FS_CONTIG_26780_1 2825 2455 2676 chr22
    47748585 13073727 13073848 2 45,21,  249,349,  13073727,13073827,

Be aware that the coordinates for a negative strand in a PSL line are handled in a special way. In the qStart and qEnd fields, the coordinates indicate the position where the query matches from the point of view of the forward strand, even when the match is on the reverse strand. However, in the qStarts list, the coordinates are reversed.

Example:
Here is a 30-mer containing 2 blocks that align on the minus strand and 2 blocks that align on the plus strand (this sometimes can happen in response to assembly errors):

0         1         2         3 tens position in query  
0123456789012345678901234567890 ones position in query   
            ++++          +++++ plus strand alignment on query   
    --------    ----------      minus strand alignment on query   

Plus strand:   
     qStart=12 
     qEnd=31 
     blockSizes=4,5 
     qStarts=12,26 
                  
Minus strand:   
     qStart=4 
     qEnd=26 
     blockSizes=10,8 
     qStarts=5,19   
Essentially, the minus strand blockSizes and qStarts are what you would get if you reverse-complemented the query. However, the qStart and qEnd are not reversed. To convert one to the other:
     qStart = qSize - revQEnd
     qEnd = qSize - revQStart


  GFF format
 

GFF (General Feature Format) lines are based on the GFF standard file format. GFF lines have nine required fields that must be tab-separated. If the fields are separated by spaces instead of tabs, the track will not display correctly. For more information on GFF format, refer to http://www.sanger.ac.uk/Software/formats/GFF.

Here is a brief description of the GFF fields:

  1. seqname - The name of the sequence. Must be a chromosome or scaffold.
  2. source - The program that generated this feature.
  3. feature - The name of this type of feature. Some examples of standard feature types are "CDS", "start_codon", "stop_codon", and "exon".
  4. start - The starting position of the feature in the sequence. The first base is numbered 1.
  5. end - The ending position of the feature (inclusive).
  6. score - A score between 0 and 1000. If the track line useScore attribute is set to 1 for this annotation data set, the score value will determine the level of gray in which this feature is displayed (higher numbers = darker gray). If there is no score value, enter ".".
  7. strand - Valid entries include '+', '-', or '.' (for don't know/don't care).
  8. frame - If the feature is a coding exon, frame should be a number between 0-2 that represents the reading frame of the first base. If the feature is not a coding exon, the value should be '.'.
  9. group - All lines with the same group are linked together into a single item.

Example:
Here's an example of a GFF-based track. Click here for a copy of this example that can be pasted into the browser without editing. NOTE: Paste operations on some operating systems will replace tabs with spaces, which will result in an error when the GFF track is uploaded. You can circumvent this problem by pasting the URL of the above example (http://genome.ucsc.edu/goldenPath/help/regulatory.txt) instead of the text itselfinto the custom annotation track text box.

track name=regulatory description="TeleGene(tm) Regulatory Regions"
chr22  TeleGene enhancer  1000000  1001000  500 +  .  touch1
chr22  TeleGene promoter  1010000  1010100  900 +  .  touch1
chr22  TeleGene promoter  1020000  1020000  800 -  .  touch2


  GTF format
 

GTF (Gene Transfer Format) is a refinement to GFF that tightens the specification. The first eight GTF fields are the same as GFF. The group field has been expanded into a list of attributes. Each attribute consists of a type/value pair. Attributes must end in a semi-colon, and be separated from any following attribute by exactly one space.

The attribute list must begin with the two mandatory attributes:

  • gene_id value - A globally unique identifier for the genomic source of the sequence.
  • transcript_id value - A globally unique identifier for the predicted transcript.

Example:
Here is an example of the ninth field in a GTF data line:

    gene_id "Em:U62317.C22.6.mRNA"; transcript_id "Em:U62317.C22.6.mRNA"; exon_number 1

For more information on this format, see http://mblab.wustl.edu/software/validate-gtf/.

The Genome Browser groups together GTF lines that have the same transcript_id value. It only looks at features of type exon and CDS.



  MAF format
 

The multiple alignment format stores a series of multiple alignments in a format that is easy to parse and relatively easy to read. This format stores multiple alignments at the DNA level between entire genomes. Previously used formats are suitable for multiple alignments of single proteins or regions of DNA without rearrangements, but would require considerable extension to cope with genomic issues such as forward and reverse strand directions, multiple pieces to the alignment, and so forth.

General Structure

The .maf format is line-oriented. Each multiple alignment ends with a blank line. Each sequence in an alignment is on a single line, which can get quite long, but there is no length limit. Words in a line are delimited by any white space. Lines starting with # are considered to be comments. Lines starting with ## can be ignored by most programs, but contain meta-data of one form or another.

The file is divided into paragraphs that terminate in a blank line. Within a paragraph, the first word of a line indicates its type. Each multiple alignment is in a separate paragraph that begins with an "a" line and contains an "s" line for each sequence in the multiple alignment. Some MAF files may contain other optional line types:

  • an "i" line containing information about what is in the aligned species DNA before and after the immediately preceding "s" line
  • an "e" line containing information about the size of the gap between the alignments that span the current block
  • a "q" line indicating the quality of each aligned base for the species

Parsers may ignore any other types of paragraphs and other types of lines within an alignment paragraph.

Custom Tracks

The first line of a custom MAF track must be a "track" line that contains a name=value pair specifying the track name. Here is an example of a minimal track line:

 track name=sample
The following variables can be specified in the track line of a custom MAF:
  • name=sample - Required. Name the track
  • description="Sample Track" - Optional. Gives a long name for the track
  • frames=multiz28wayFrames - Optional. Tells the browser which table to grab the gene frames from. This is usually associated with an N-way alignment where the name ends in the string "Frames"
  • mafDot=on - Optional. Use dots instead of bases when bases are identical
  • visibility=dense|pack|full - Optional. Sets the default visibility mode for this track.
  • speciesOrder="hg18 panTro2" - Optional. White-space separated list specifying the order in which the sequences in the maf should be displayed.
The second line of a custom MAF track must be a header line as described below.

Header Line

The first line of a .maf file begins with ##maf. This word is followed by white-space-separated variable=value pairs. There should be no white space surrounding the "=".

 ##maf version=1 scoring=tba.v8 
The currently defined variables are:
  • version - Required. Currently set to one.
  • scoring - Optional. A name for the scoring scheme used for the alignments. The current scoring schemes are:
    • bit - roughly corresponds to blast bit values (roughly 2 points per aligning base minus penalties for mismatches and inserts).
    • blastz - blastz scoring scheme -- roughly 100 points per aligning base.
    • probability - some score normalized between 0 and 1.
  • program - Optional. Name of the program generating the alignment.
Undefined variables are ignored by the parser.

Alignments Parameter Line

The second line displays the parameters that were used to run the alignment program.

 # tba.v8 (((human chimp) baboon) (mouse rat))

Alignment Block Lines (lines starting with 'a' -- parameters for a new alignment block)

 a score=23262.0
Each alignment begins with an 'a' line that set variables for the entire alignment block. The 'a' is followed by name=value pairs. There are no required name=value pairs. The currently defined variables are:
  • score -- Optional. Floating point score. If this is present, it is good practice to also define scoring in the first line.
  • pass -- Optional. Positive integer value. For programs that do multiple pass alignments such as blastz, this shows which pass this alignment came from. Typically, pass 1 will find the strongest alignments genome-wide, and pass 2 will find weaker alignments between two first-pass alignments.

Lines starting with 's' -- a sequence within an alignment block

 s hg16.chr7    27707221 13 + 158545518 gcagctgaaaaca
 s panTro1.chr6 28869787 13 + 161576975 gcagctgaaaaca
 s baboon         249182 13 +   4622798 gcagctgaaaaca
 s mm4.chr6     53310102 13 + 151104725 ACAGCTGAAAATA
The 's' lines together with the 'a' lines define a multiple alignment. The 's' lines have the following fields which are defined by position rather than name=value pairs.
  • src -- The name of one of the source sequences for the alignment. For sequences that are resident in a browser assembly, the form 'database.chromosome' allows automatic creation of links to other assemblies. Non-browser sequences are typically reference by the species name alone.
  • start -- The start of the aligning region in the source sequence. This is a zero-based number. If the strand field is '-' then this is the start relative to the reverse-complemented source sequence.
  • size -- The size of the aligning region in the source sequence. This number is equal to the number of non-dash characters in the alignment text field below.
  • strand -- Either '+' or '-'. If '-', then the alignment is to the reverse-complemented source.
  • srcSize -- The size of the entire source sequence, not just the parts involved in the alignment.
  • text -- The nucleotides (or amino acids) in the alignment and any insertions (dashes) as well.

Lines starting with 'i' -- information about what's happening before and after this block in the aligning species

 s hg16.chr7    27707221 13 + 158545518 gcagctgaaaaca s panTro1.chr6 28869787 13 + 161576975 gcagctgaaaaca
 i panTro1.chr6 N 0 C 0
 s baboon         249182 13 +   4622798 gcagctgaaaaca
 i baboon       I 234 n 19

The 'i' lines contain information about the context of the sequence lines immediately preceeding them. The following fields are defined by position rather than name=value pairs:

  • src -- The name of the source sequence for the alignment. Should be the same as the 's' line immediately above this line.
  • leftStatus -- A character that specifies the relationship between the sequence in this block and the sequence that appears in the previous block.
  • leftCount -- Usually the number of bases in the aligning species between the start of this alignment and the end of the previous one.
  • rightStatus -- A character that specifies the relationship between the sequence in this block and the sequence that appears in the subsequent block.
  • rightCount -- Usually the number of bases in the aligning species between the end of this alignment and the start of the next one.

The status characters can be one of the following values:

  • C -- the sequence before or after is contiguous with this block.
  • I -- there are bases between the bases in this block and the one before or after it.
  • N -- this is the first sequence from this src chrom or scaffold.
  • n -- this is the first sequence from this src chrom or scaffold but it is bridged by another alignment from a different chrom or scaffold.
  • M -- there is missing data before or after this block (Ns in the sequence).
  • T -- the sequence in this block has been used before in a previous block (likely a tandem duplication)

Lines starting with 'e' -- information about empty parts of the alignment block

 s hg16.chr7    27707221 13 + 158545518 gcagctgaaaaca
 e mm4.chr6     53310102 13 + 151104725 I

The 'e' lines indicate that there isn't aligning DNA for a species but that the current block is bridged by a chain that connects blocks before and after this block. The following fields are defined by position rather than name=value pairs.

  • src -- The name of one of the source sequences for the alignment.
  • start -- The start of the non-aligning region in the source sequence. This is a zero-based number. If the strand field is '-' then this is the start relative to the reverse-complemented source sequence.
  • size -- The size in base pairs of the non-aligning region in the source sequence.
  • strand -- Either '+' or '-'. If '-', then the alignment is to the reverse-complemented source.
  • srcSize -- The size of the entire source sequence, not just the parts involved in the alignment. alignment and any insertions (dashes) as well.
  • status -- A character that specifies the relationship between the non-aligning sequence in this block and the sequence that appears in the previous and subsequent blocks.

The status character can be one of the following values:

  • C -- the sequence before and after is contiguous implying that this region was either deleted in the source or inserted in the reference sequence. The browser draws a single line or a '-' in base mode in these blocks.
  • I -- there are non-aligning bases in the source species between chained alignment blocks before and after this block. The browser shows a double line or '=' in base mode.
  • M -- there are non-aligning bases in the source and more than 90% of them are Ns in the source. The browser shows a pale yellow bar.
  • n -- there are non-aligning bases in the source and the next aligning block starts in a new chromosome or scaffold that is bridged by a chain between still other blocks. The browser shows either a single line or a double line based on how many bases are in the gap between the bridging alignments.
Lines starting with 'q' -- information about the quality of each aligned base for the species

 s hg18.chr1                  32741 26 + 247249719 TTTTTGAAAAACAAACAACAAGTTGG
 s panTro2.chrUn            9697231 26 +  58616431 TTTTTGAAAAACAAACAACAAGTTGG
 q panTro2.chrUn                                   99999999999999999999999999
 s dasNov1.scaffold_179265     1474  7 +      4584 TT----------AAGCA---------
 q dasNov1.scaffold_179265                         99----------32239--------- 

The 'q' lines contain a compressed version of the actual raw quality data, representing the quality of each aligned base for the species with a single character of 0-9 or F. The following fields are defined by position rather than name=value pairs:

  • src -- The name of the source sequence for the alignment. Should be the same as the 's' line immediately preceding this line.
  • value -- A MAF quality value corresponding to the aligning nucleotide acid in the preceding 's' line. Insertions (dashes) in the preceding 's' line are represented by dashes in the 'q' line as well. The quality value can be 'F' (finished sequence) or a number derived from the actual quality scores (which range from 0-97) or the manually assigned score of 98. These numeric values are calculated as:
    MAF quality value = min( floor(actual quality value/5), 9 )
    This results in the following mapping:

    MAF quality value Raw quality score range Quality level
    0-8 0-44 Low
    9 45-97 High
    0 98 Manually assigned
    F 99 Finished


A Simple Example

Here is a simple example of a three alignment blocks derived from five starting sequences. The first track line is necessary for custom tracks, but should be removed otherwise. Repeats are shown as lowercase, and each block may have a subset of the input sequences. All sequence columns and rows must contain at least one nucleotide (no columns or rows that contain only insertions).

 
track name=euArc visibility=pack
##maf version=1 scoring=tba.v8 
# tba.v8 (((human chimp) baboon) (mouse rat)) 
                   
a score=23262.0     
s hg18.chr7    27578828 38 + 158545518 AAA-GGGAATGTTAACCAAATGA---ATTGTCTCTTACGGTG
s panTro1.chr6 28741140 38 + 161576975 AAA-GGGAATGTTAACCAAATGA---ATTGTCTCTTACGGTG
s baboon         116834 38 +   4622798 AAA-GGGAATGTTAACCAAATGA---GTTGTCTCTTATGGTG
s mm4.chr6     53215344 38 + 151104725 -AATGGGAATGTTAAGCAAACGA---ATTGTCTCTCAGTGTG
s rn3.chr4     81344243 40 + 187371129 -AA-GGGGATGCTAAGCCAATGAGTTGTTGTCTCTCAATGTG
                   
a score=5062.0                    
s hg18.chr7    27699739 6 + 158545518 TAAAGA
s panTro1.chr6 28862317 6 + 161576975 TAAAGA
s baboon         241163 6 +   4622798 TAAAGA 
s mm4.chr6     53303881 6 + 151104725 TAAAGA
s rn3.chr4     81444246 6 + 187371129 taagga

a score=6636.0
s hg18.chr7    27707221 13 + 158545518 gcagctgaaaaca
s panTro1.chr6 28869787 13 + 161576975 gcagctgaaaaca
s baboon         249182 13 +   4622798 gcagctgaaaaca
s mm4.chr6     53310102 13 + 151104725 ACAGCTGAAAATA
 


  WIG format
 

Wiggle format (WIG) allows the display of continuous-valued data in a track format. Click here for more information.



  bigWig format
 

The bigWig format is for display of dense, continuous data that will be displayed in the Genome Browser as a graph. BigWig files are created initially from wiggle (wig) type files, using the program wigToBigWig. The resulting bigWig files are in an indexed binary format. The main advantage of the bigWig files is that only the portions of the files needed to display a particular region are transferred to UCSC, so for large data sets bigWig is considerably faster than regular wiggle files. The bigWig file remains on your web accessible server (http, https, or ftp), not on the UCSC server. Only the portion that is needed for the chromosomal position you are currently viewing is locally cached as a "sparse file".

Click here for more information on the bigWig format.



  Microarray format
 

The datasets for the built-in microarray tracks in the Genome Browser are stored in BED15 format, an extension of BED format that includes three additional fields: expCount, expIds, and expScores. To display correctly in the Genome Browser, microarray tracks require the setting of several attributes in the trackDb file associated with the track's genome assembly. Each microarray track set must also have an associated microarrayGroups.ra configuration file that contains additional information about the data in each of the arrays.

User-created microarray custom tracks are similar in format to BED custom tracks with the addition of three required track line parameters in the header--expNames, expScale, and expStep--that mimic the trackDb and microarrayGroups.ra settings of built-in microarray tracks.

For a complete description of the microarray track format and an explanation of how to construct a microarray custom track, see the Genome Browser Wiki.



  .2bit format
 

A .2bit file stores multiple DNA sequences (up to 4 Gb total) in a compact randomly-accessible format. The file contains masking information as well as the DNA itself.

The file begins with a 16-byte header containing the following fields:

  • signature - the number 0x1A412743 in the architecture of the machine that created the file
  • version - zero for now. Readers should abort if they see a version number higher than 0.
  • sequenceCount - the number of sequences in the file.
  • reserved - always zero for now

All fields are 32 bits unless noted. If the signature value is not as given, the reader program should byte-swap the signature and check if the swapped version matches. If so, all multiple-byte entities in the file will have to be byte-swapped. This enables these binary files to be used unchanged on different architectures.

The header is followed by a file index, which contains one entry for each sequence. Each index entry contains three fields:

  • nameSize - a byte containing the length of the name field
  • name - the sequence name itself, of variable length depending on nameSize
  • offset - the 32-bit offset of the sequence data relative to the start of the file

The index is followed by the sequence records, which contain nine fields:

  • dnaSize - number of bases of DNA in the sequence
  • nBlockCount - the number of blocks of Ns in the file (representing unknown sequence)
  • nBlockStarts - the starting position for each block of Ns
  • nBlockSizes - the size of each block of Ns
  • maskBlockCount - the number of masked (lower-case) blocks
  • maskBlockStarts - the starting position for each masked block
  • maskBlockSizes - the size of each masked block
  • reserved - always zero for now
  • packedDna - the DNA packed to two bits per base, represented as so: T - 00, C - 01, A - 10, G - 11. The first base is in the most significant 2-bit byte; the last base is in the least significant 2 bits. For example, the sequence TCAG is represented as 00011011. The packedDna field is padded with 0 bits as necessary to take an even multiple of 32 bits in the file, which improves I/O performance on some machines.


  .nib format
 

The .nib format pre-dates the .2bit format and is less compact. It describes a DNA sequence by packing two bases into each byte. Each .nib file contains only a single sequence. The file begins with a 32-bit signature that is 0x6BE93D3A in the architecture of the machine that created the file (or possibly a byte-swapped version of the same number on another machine). This is followed by a 32-bit number in the same format that describes the number of bases in the file. Next, the bases themselves are listed, packed two bases to the byte. The first base is packed in the high-order 4 bits (nibble); the second base is packed in the low-order four bits:

byte = (base1<<4) + base2

The numerical representations for the bases are:

  • 0 - T
  • 1 - C
  • 2 - A
  • 3 - G
  • 4 - N (unknown)

The most significant bit in a nibble is set if the base is masked.



  GenePred table format
 

genePred is a table format commonly used for gene prediction tracks in the Genome Browser. Variations of the genePred format are listed below.

Gene Predictions

The following definition is used for gene prediction tables. In alternative-splicing situations, each transcript has a row in this table.
table genePred
"A gene prediction."
    (
    string  name;               "Name of gene"
    string  chrom;              "Chromosome name"
    char[1] strand;             "+ or - for strand"
    uint    txStart;            "Transcription start position"
    uint    txEnd;              "Transcription end position"
    uint    cdsStart;           "Coding region start"
    uint    cdsEnd;             "Coding region end"
    uint    exonCount;          "Number of exons"
    uint[exonCount] exonStarts; "Exon start positions"
    uint[exonCount] exonEnds;   "Exon end positions"
    )

Gene Predictions (Extended)

The following definition is used for extended gene prediction tables. In alternative-splicing situations, each transcript has a row in this table. The refGene table is an example of the genePredExt format.
table genePredExt
"A gene prediction with some additional info."
    (
    string name;        	"Name of gene (usually transcript_id from GTF)"
    string chrom;       	"Chromosome name"
    char[1] strand;     	"+ or - for strand"
    uint txStart;       	"Transcription start position"
    uint txEnd;         	"Transcription end position"
    uint cdsStart;      	"Coding region start"
    uint cdsEnd;        	"Coding region end"
    uint exonCount;     	"Number of exons"
    uint[exonCount] exonStarts; "Exon start positions"
    uint[exonCount] exonEnds;   "Exon end positions"
    uint id;            	"Unique identifier"
    string name2;       	"Alternate name (e.g. gene_id from GTF)"
    string cdsStartStat; 	"enum('none','unk','incmpl','cmpl')"
    string cdsEndStat;   	"enum('none','unk','incmpl','cmpl')"
    lstring exonFrames; 	"Exon frame offsets {0,1,2}"
    )

Gene Predictions and RefSeq Genes with Gene Names

A version of genePred that associates the gene name with the gene prediction information. In alternative-splicing situations, each transcript has a row in this table.
table refFlat
"A gene prediction with additional geneName field."
    (
    string  geneName;           "Name of gene as it appears in Genome Browser."
    string  name;               "Name of gene"
    string  chrom;              "Chromosome name"
    char[1] strand;             "+ or - for strand"
    uint    txStart;            "Transcription start position"
    uint    txEnd;              "Transcription end position"
    uint    cdsStart;           "Coding region start"
    uint    cdsEnd;             "Coding region end"
    uint    exonCount;          "Number of exons"
    uint[exonCount] exonStarts; "Exon start positions"
    uint[exonCount] exonEnds;   "Exon end positions"
    )